5 retrieving data from a sub activity back to your main activity
android cookbook
Ngày tải lên :
03/05/2014, 20:40
... Default shared preferences consistency check Advanced text search How to push string-values using Intent.putExtra() Retrieving data from a Sub- Activity back to your Main Activity Getting total and ... system and the reliability and portability of a standard high-level language and API Android apps are written in the Java language, using tools such as Eclipse, compiled against the Android API, and ... Linux-based cell phone projects Android is also related by programming language to Blackberry and JavaME phones, and to Java and the wider realm of Java Enterprise applications Android sales have...
- 688
- 1.4K
- 0
Tài liệu Module 1: Displaying Data from a Database docx
Ngày tải lên :
11/12/2013, 14:15
... connecting to a database by using the Database Results Wizard Lead-in The Database Results Wizard helps to establish a connection between a Web page and a database After importing a database to the ... within a FrontPage-based application, you need to connect to a database using the Database Results Wizard Module 1: Displaying Data from a Database Demonstration: Importing a Database to the ... need to create a connection to the database to access information from a database on a site FrontPage provides the Database Results Wizard to create a connection to the database Delivery Tip Start...
- 40
- 540
- 0
Tài liệu Retrieving Data from an Oracle Package ppt
Ngày tải lên :
14/12/2013, 18:16
... cmd.Parameters["pCustomerID"].Value = customerIdTextBox.Text; // Create the DataAdapter and table mappings OracleDataAdapter da = new OracleDataAdapter(cmd); da.TableMappings.Add("Table", "ORDERS"); da.TableMappings.Add("Table1", ... da.TableMappings.Add("Table1", "ORDERDETAILS"); // Fill the DataSet from the Oracle package DataSet ds = new DataSet( ); da.Fill(ds); // Create a relation ds.Relations.Add("ORDERS_ORDERDETAILS_RELATION", ... Oracle stored procedure Instead, you must use an Oracle package, that is, a container that groups stored procedures and functions An Oracle package consists of a header and a body The package...
- 5
- 377
- 0
Tài liệu Module 1: Displaying Data from a Database ppt
Ngày tải lên :
21/12/2013, 19:15
... connecting to a database by using the Database Results Wizard Lead-in The Database Results Wizard helps to establish a connection between a Web page and a database After importing a database to the ... within a FrontPage-based application, you need to connect to a database using the Database Results Wizard Module 1: Displaying Data from a Database Demonstration: Importing a Database to the ... need to create a connection to the database to access information from a database on a site FrontPage provides the Database Results Wizard to create a connection to the database Delivery Tip Start...
- 40
- 451
- 0
Tài liệu Updating a Data Source with Data from a Different Data Source doc
Ngày tải lên :
21/01/2014, 11:20
... DataSet tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet ... destination DataAdapter is called using the DataSet containing the changes as the data object argument; this applies the changes to the destination data source The destination DataSet is then cleared ... source database server, so an Oracle table could be synchronized to reflect all changes made to a SQL Server table In fact, the data sources not even have to be databases If the destination data is...
- 4
- 326
- 0
Tài liệu Retrieving Constraints from a SQL Server Database docx
Ngày tải lên :
26/01/2014, 10:20
... CONSTRAINT_CATALOG nvarchar(128) Constraint name CONSTRAINT_SCHEMA nvarchar(128) Constraint owner CONSTRAINT_NAME sysname TABLE_CATALOG nvarchar(128) Database name TABLE_SCHEMA nvarchar(128) Table ... System.EventArgs e) { // Create the DataAdapter to retrieve schema information SqlDataAdapter da = null; if (primaryKeyRadioButton.Checked) da = new SqlDataAdapter(GETPRIMARYKEYCONSTRAINTS, ConfigurationSettings.AppSettings["Sql_ConnectString"]); ... current database Table 6-10 REFERENTIAL_CONSTRAINTS information schema view Column name Data type Description CONSTRAINT_CATALOG nvarchar(128) Database name CONSTRAINT_SCHEMA nvarchar(128) Constraint...
- 7
- 393
- 0
Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc
Ngày tải lên :
22/03/2014, 18:20
... unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a three-latent class ... the data It indicates the amount of the relationship between the variables that remains unexplained by a model; the larger the value, the poorer the model fits the data As a rule of thumb, a good ... estimated Se and Spe of disease characteristics with an LCA strategy [17,27,28] In patients for whom results from at least diagnostic TB tests are available, LCA can distinguish two subgroups: “patients...
- 7
- 506
- 0
Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf
Ngày tải lên :
11/08/2014, 17:20
... Milliken et al (2007) age; percentage for all other variables c UK data weighted to take account of sampling weights d Demographic data are not separately available for those on active duty and those ... statistical power than envisaged as the final response rate was 76% Analysis All statistical analyses were undertaken using the statistical software package STATA (version 10.0) [22] Weighted and ... US data are limited in several ways First, although the data relate to the same Iraq deployment, they were collected in different ways The PDHRA data was collected cross-sectionally in 20056 and...
- 12
- 469
- 0
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot
Ngày tải lên :
12/08/2014, 03:20
... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT...
- 10
- 250
- 0
Báo cáo y học: "Hyperuricemia and the risk for subclinical coronary atherosclerosis - data from a prospective observational cohort study" potx
Ngày tải lên :
12/08/2014, 15:23
... takes responsibility for the integrity of the data and the accuracy of the data analysis Takeda Pharmaceuticals International, Inc did not have access to the raw data, and Takeda Pharmaceuticals ... Clinical Cardiology Circulation 2006, 114:1761-1791 Tanaka M, Tomiyasu K, Fukui M, Akamabe S, Kobayashi-Takenaka Y, Nakano K, Kadono M, Hasegawa G, Oda Y, Nakamura N: Evaluation of characteristics ... 158) had an Agatston score of greater than 10, and 1.4% (n = 34) had an Agatston score of greater than 100 As expected in a cohort free of clinical CAD, relatively few participants had an Agatston...
- 8
- 350
- 0
Báo cáo y học: "Health related quality of life in trauma patients. Data from a one-year follow up study compared with the general population" potx
Ngày tải lên :
13/08/2014, 23:20
... When an item was missing on the HADS and IES, missing data were replaced with the patients’ mean value for each subscale Data on categorical variables are presented as numbers and percentages, and ... the data, performing the data analyses and writing the article LS also collected data ISB, LS and HM participated in the planning of the study and discussions during data analyses, read the manuscript ... ability to answer the questionnaire was assessed by a nurse at the ward or rehabilitation institution the patient was transferred to after the ICU stay If the patient was assessed unable to answer...
- 12
- 383
- 0
Bringing a Dying Brand Back to Life
Ngày tải lên :
24/10/2013, 08:20
... and around the business Many arranged to play ten to 15 games a year at their facilof the organization’s oldity in Orlando, and we timers had to leave They have our annual training couldn’t adapt ... order to become relevant again; second, customers had to be shown that we really cared about them; and third, an accountable organization had to be created a real business Before we get to that, ... get in touch with that group and say, “We’re coming to town, what can we for you?” For example, I might donate my time and speak at a fund-raising dinner at an organization’s annual meeting To get...
- 16
- 499
- 1
peachpit press ios 5 in the enterprise, a hands-on guide to managing iphones and ipads (2012)
Ngày tải lên :
24/04/2014, 10:00
... you want to maintain control of what apps are installed or deleted, you can that here You can also prevent changes in email accounts, disable camera usage, manage in-app purchases, and disable ... management has to make life easier for the user A happy side benefit to this is that when done right, it makes your life easier, too When a user can personally take an iPhone from activation to ... the address for the email server we use Have a nice day.” But as your company grows, or if you have data that you need to control securely, then you need ensure that your data is set up and managed...
- 258
- 2.7K
- 0
Báo cáo toán học: "From a Polynomial Riemann Hypothesis to Alternating Sign Matrices" pptx
Ngày tải lên :
07/08/2014, 06:22
... This leads to the following equations: a1 + a2 + a3 = a1 t1 + a2 t2 + a3 t3 = a1 tk+2 a1 tk+3 + a2 tk+2 + a3 tk+2 = + a2 tk+3 + a3 tk+3 = Note that the a1 , a2 , a3 cannot be trivial because a1 t2 ... viewed as a single asymptotic version of the Quadratic Polynomial Riemann hypothesis, and again, substantial amount of data indicates its truth On the other hand, this conjecture is readily phrased ... polynomials T [(x + r)n + (1 − x + r)n ](s) (2) satisfy a Riemann hypothesis for all n > and all values of the real parameter r A substantial amount of numerical evidence indicates that a great deal...
- 51
- 203
- 0
Báo cáo toán học: "From a 1-rotational RBIBD to a Partitioned Difference Family." docx
Ngày tải lên :
08/08/2014, 12:22
... gives rise to a PDF if we allow to have some base blocks of size one It is also trivial to see that a PDF having all blocks of the same size cannot exist What about PDFs having exactly two block ... on V leaving invariant B or R, respectively In particular, a BIBD or RBIBD is said to be 1-rotational under G if it admits G as an automorphism group fixing one point and acting sharply transitively ... immediate to see that each Pi is a parallel class of the BIBD generated by F and G that P1 ∪ ∪ PtG is a G-invariant resolution of it the electronic journal of combinatorics 17 (2010), #R139 Example...
- 23
- 298
- 0
A soft switch back to back bi directional DC DC converter and the FPGA based digital control design
Ngày tải lên :
12/09/2015, 08:20
... Woo Ying Chee and Mr Mukaya Chandra (Electrical Machines & Drives Laboratory) and Mr Abdul Jalil Bin Din (PCB Fabrication Facility) I also thank the National University of Singapore for providing ... changes from half load to full load, (b) load changes from full load to half load Dynamic response of the close loop system in step-up mode operation: (a) load changes from half load to full ... gate -to- source capacitance of MOSFETs, Cds : drain -to- source capacitance of MOSFETs, Cgd : gate -to- drain capacitance of MOSFETs, Rds(ON) : static drain -to- source on-resistance, Vds : drain -to- source...
- 232
- 861
- 0
Letters from a Self made merchant to his son
Ngày tải lên :
08/12/2015, 12:37
... education IV 31 From John Graham, head at the of the house of Union Stock Yards pont Graham, at the Waldorf-Astoria, Mr Pierrepont has suggested proper finish V to his From John Graham, head Graham ... University, Camat the Mr Pierrepont has just become a member, in good and regular standing, of the Freshman class II From John Graham, at the Union Stock Yards in Chicago, Harvard University to his ... John Graham, at the Union Stock Yards to his son, Pierrepont, at The started 67 in Chicago, Planters' Palace Hotel at Big Gap, Kentucky Mr Pierrepont's orders are small and his expenses are large,...
- 128
- 237
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
Ngày tải lên :
03/11/2012, 11:44
... Female Male AVNRT AVRT EAT From symptom to diagnosis (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT ... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily...
- 9
- 679
- 0
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB - phần 5
Ngày tải lên :
24/10/2013, 08:20
... physical property can be a liability All a company needs is access to physical assets To operate as a lean company may call for decapitalizing—outsourcing activities and shrinking working capital ... achieved Approach • Sales analysis • Market-share analysis • Sales -to- expense ratios • Financial analysis • Market-based scorecard analysis Implementation and Control 79 Prime Responsibility Marketing ... 78 Marketing Insights from A to Z A major bank announced a new savings plan in the newspapers but hadn’t explained the plan to its branch managers An engineering firm made a decision to sell...
- 20
- 574
- 0
Tài liệu Retrieving a Single Value from a Query pdf
Ngày tải lên :
14/12/2013, 18:16
... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... therefore improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the...
- 2
- 312
- 0